|
Left Crispr |
Right Crispr |
| Crispr ID |
963721896 |
963721907 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:148871018-148871040
|
3:148871069-148871091
|
| Sequence |
CCTCCCGAGTAGCTTATACTACA |
TTGTATTTTTAGTAAAGACGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 23, 2: 2766, 3: 73360, 4: 215646} |
{0: 2220, 1: 106635, 2: 222607, 3: 147977, 4: 77177} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|