ID: 963778499_963778506

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 963778499 963778506
Species Human (GRCh38) Human (GRCh38)
Location 3:149464029-149464051 3:149464066-149464088
Sequence CCGGTGTAGTGCATCACGCAGGT GGAGGGTGTGCGCGTCTCCTGGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 1, 3: 2, 4: 74} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!