ID: 963806090_963806097

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 963806090 963806097
Species Human (GRCh38) Human (GRCh38)
Location 3:149724485-149724507 3:149724515-149724537
Sequence CCCCCCAGACTCCTTAAAAAAAA CAGTTTTTAATCCTTTCCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 444} {0: 1, 1: 0, 2: 5, 3: 17, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!