ID: 963843605_963843614

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 963843605 963843614
Species Human (GRCh38) Human (GRCh38)
Location 3:150132719-150132741 3:150132755-150132777
Sequence CCTCTGACCCAGCTCTTACTTTT CTGTGCAGGAAGAGGGAAGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 84, 4: 760}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!