ID: 963843927_963843931

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 963843927 963843931
Species Human (GRCh38) Human (GRCh38)
Location 3:150135525-150135547 3:150135578-150135600
Sequence CCAGCAGGCTACAGAATGTTCTC AAACTTGCTTTGCATTTGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 151} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!