ID: 963844015_963844022

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 963844015 963844022
Species Human (GRCh38) Human (GRCh38)
Location 3:150136668-150136690 3:150136705-150136727
Sequence CCATTTTGACAAATGCCAGATAC CTGAAGTCAAAAATGGAGAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 61, 4: 612}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!