ID: 963870391_963870400

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 963870391 963870400
Species Human (GRCh38) Human (GRCh38)
Location 3:150409050-150409072 3:150409098-150409120
Sequence CCGCCTCTGAGGGAATTGAATTG AAGGAAGGAGGAGCCGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107} {0: 1, 1: 0, 2: 1, 3: 23, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!