ID: 963882904_963882907

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 963882904 963882907
Species Human (GRCh38) Human (GRCh38)
Location 3:150547858-150547880 3:150547897-150547919
Sequence CCAGGCAAAGACTGTTTAAAAGG ATTTTTTTTTAGGTTTGTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 211} {0: 1, 1: 1, 2: 10, 3: 150, 4: 1766}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!