ID: 963886514_963886515

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 963886514 963886515
Species Human (GRCh38) Human (GRCh38)
Location 3:150588757-150588779 3:150588781-150588803
Sequence CCTATAAAAGTCTAGCACTTACA TTATGTACAGTACATAATACTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 13, 3: 29, 4: 173} {0: 6, 1: 9, 2: 12, 3: 18, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!