ID: 963902483_963902487

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 963902483 963902487
Species Human (GRCh38) Human (GRCh38)
Location 3:150745853-150745875 3:150745882-150745904
Sequence CCTCTATCCTAGAGCACACAGAA AGCTGTGGATCCTGCCCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 180} {0: 1, 1: 1, 2: 3, 3: 38, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!