ID: 963908179_963908193

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 963908179 963908193
Species Human (GRCh38) Human (GRCh38)
Location 3:150791503-150791525 3:150791541-150791563
Sequence CCATGTGCCCTCCACACACAGAG GGGGCTGCTTTGTTCTTTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 42, 4: 415} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!