|
Left Crispr |
Right Crispr |
| Crispr ID |
963925581 |
963925584 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:150947443-150947465
|
3:150947481-150947503
|
| Sequence |
CCACACAATAGTAGTAGGAGACT |
CAGTATTAGATCATGGAGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 118, 2: 1590, 3: 5377, 4: 5377} |
{0: 1, 1: 2, 2: 7, 3: 14, 4: 134} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|