ID: 963940432_963940437

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 963940432 963940437
Species Human (GRCh38) Human (GRCh38)
Location 3:151091346-151091368 3:151091379-151091401
Sequence CCCTGAAGGCTGGTTGAAACAGA TCTAAGATTCAGTAGGTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 285} {0: 1, 1: 2, 2: 18, 3: 188, 4: 744}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!