ID: 963945004_963945010

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 963945004 963945010
Species Human (GRCh38) Human (GRCh38)
Location 3:151136016-151136038 3:151136053-151136075
Sequence CCTGGGGCACTGCTCTGTTTACC CTGTGCCACCTGAGGTTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 147} {0: 1, 1: 0, 2: 6, 3: 18, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!