ID: 963945006_963945010

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 963945006 963945010
Species Human (GRCh38) Human (GRCh38)
Location 3:151136038-151136060 3:151136053-151136075
Sequence CCCTAGTCATTTCCTCTGTGCCA CTGTGCCACCTGAGGTTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 25, 4: 272} {0: 1, 1: 0, 2: 6, 3: 18, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!