ID: 963948553_963948558

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 963948553 963948558
Species Human (GRCh38) Human (GRCh38)
Location 3:151172481-151172503 3:151172506-151172528
Sequence CCCATCACGCAGTCTACTAATCA AGGCACAGCCAGGATCTTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 42} {0: 1, 1: 0, 2: 1, 3: 16, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!