ID: 963949714_963949716

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 963949714 963949716
Species Human (GRCh38) Human (GRCh38)
Location 3:151185539-151185561 3:151185554-151185576
Sequence CCTCATTATGTTATTCTTTTGCT CTTTTGCTCTTGAGGAAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 655} {0: 1, 1: 0, 2: 2, 3: 15, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!