ID: 964010406_964010418

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 964010406 964010418
Species Human (GRCh38) Human (GRCh38)
Location 3:151885637-151885659 3:151885675-151885697
Sequence CCCAGTCAGGGGCTTGTAGATAA GGGACAGACACCTGGGGGAAGGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 6, 3: 58, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!