ID: 964065791_964065796

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 964065791 964065796
Species Human (GRCh38) Human (GRCh38)
Location 3:152577253-152577275 3:152577294-152577316
Sequence CCATCTCTACAAAAAAATACACT CTGTAATCCCAGCTACTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 31, 2: 1675, 3: 11666, 4: 19554} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!