ID: 964134149_964134152

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 964134149 964134152
Species Human (GRCh38) Human (GRCh38)
Location 3:153325620-153325642 3:153325663-153325685
Sequence CCTGCAAGTTGCTTTGGGCAGTA ATTATTCCTGCCCATGAGTATGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 209, 3: 7982, 4: 8070}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!