ID: 964164243_964164245

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 964164243 964164245
Species Human (GRCh38) Human (GRCh38)
Location 3:153682357-153682379 3:153682376-153682398
Sequence CCACACTCCATAATTCTCTTGGT TGGTTGTGAGACAATGAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 28, 3: 57, 4: 242} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!