|
Left Crispr |
Right Crispr |
| Crispr ID |
964223025 |
964223033 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:154368129-154368151
|
3:154368157-154368179
|
| Sequence |
CCAGATTTCCTGGTTGAGACCAT |
CGCCAGAGGCTCCCCCTGCAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 6, 2: 8, 3: 8, 4: 135} |
{0: 3, 1: 7, 2: 2, 3: 20, 4: 208} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|