ID: 964232664_964232668

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 964232664 964232668
Species Human (GRCh38) Human (GRCh38)
Location 3:154488478-154488500 3:154488499-154488521
Sequence CCCCAAGACACATAGCATCAGAT ATTCTGCAAGGTTGAAATGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 216, 2: 1946, 3: 6581, 4: 2102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!