ID: 964282309_964282317

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 964282309 964282317
Species Human (GRCh38) Human (GRCh38)
Location 3:155079979-155080001 3:155080006-155080028
Sequence CCAACTTCTCCCGAATCCCACTG GTCCCAGGAGAGCGAGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 235} {0: 1, 1: 0, 2: 3, 3: 22, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!