ID: 964302202_964302212

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 964302202 964302212
Species Human (GRCh38) Human (GRCh38)
Location 3:155301038-155301060 3:155301085-155301107
Sequence CCAAGATCATTTTGAGGGTCATC ATCAGGCCAGGACATAAGGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!