ID: 964335262_964335269

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 964335262 964335269
Species Human (GRCh38) Human (GRCh38)
Location 3:155648161-155648183 3:155648206-155648228
Sequence CCCACAAGGTCAGAGCTCAGGAA GGGAACAATAGTAGTAGTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 177} {0: 1, 1: 0, 2: 1, 3: 10, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!