|
Left Crispr |
Right Crispr |
| Crispr ID |
964344134 |
964344139 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:155738834-155738856
|
3:155738859-155738881
|
| Sequence |
CCAGCTACTCAGGAGGCTGAGGG |
AAGGACCTCTTGAGCCCTGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1034, 1: 101354, 2: 208048, 3: 241971, 4: 153021} |
{0: 1, 1: 3, 2: 134, 3: 1992, 4: 14571} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|