|
Left Crispr |
Right Crispr |
Crispr ID |
964359347 |
964359356 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:155878136-155878158
|
3:155878184-155878206
|
Sequence |
CCACCTCCCAAAGACCTCACCTC |
GTTTCAACATATGAATTTTAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 3, 2: 37, 3: 115, 4: 575} |
{0: 41, 1: 347, 2: 1456, 3: 2970, 4: 4450} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|