ID: 964359347_964359357

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 964359347 964359357
Species Human (GRCh38) Human (GRCh38)
Location 3:155878136-155878158 3:155878185-155878207
Sequence CCACCTCCCAAAGACCTCACCTC TTTCAACATATGAATTTTAGGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 37, 3: 115, 4: 575} {0: 65, 1: 522, 2: 1734, 3: 3253, 4: 4775}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!