ID: 964364746_964364750

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 964364746 964364750
Species Human (GRCh38) Human (GRCh38)
Location 3:155937935-155937957 3:155937981-155938003
Sequence CCTTTGCCTCACTTATTCTTTAT CTGTGAATATGTATGAAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 502} {0: 1, 1: 0, 2: 2, 3: 23, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!