ID: 964364747_964364750

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 964364747 964364750
Species Human (GRCh38) Human (GRCh38)
Location 3:155937941-155937963 3:155937981-155938003
Sequence CCTCACTTATTCTTTATGTATAA CTGTGAATATGTATGAAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 451} {0: 1, 1: 0, 2: 2, 3: 23, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!