|
Left Crispr |
Right Crispr |
| Crispr ID |
964375034 |
964375043 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:156041376-156041398
|
3:156041416-156041438
|
| Sequence |
CCGGGTGGGCGTGGGCTCGGCGG |
GCCAGCCGGCCTGCAAGCCCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 79, 1: 581, 2: 637, 3: 391, 4: 425} |
{0: 2, 1: 4, 2: 20, 3: 47, 4: 297} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|