ID: 964386044_964386052

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 964386044 964386052
Species Human (GRCh38) Human (GRCh38)
Location 3:156149127-156149149 3:156149168-156149190
Sequence CCCCAGTGTCCGAAGATCTCCCT CTCAGAGACTTCTGTTAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 106} {0: 1, 1: 0, 2: 2, 3: 15, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!