ID: 964390051_964390056

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 964390051 964390056
Species Human (GRCh38) Human (GRCh38)
Location 3:156187204-156187226 3:156187222-156187244
Sequence CCCTCCACCTTGGTATTTCTCAG CTCAGAGATTCATGCTTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 274} {0: 1, 1: 0, 2: 1, 3: 11, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!