ID: 964390146_964390150

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 964390146 964390150
Species Human (GRCh38) Human (GRCh38)
Location 3:156188164-156188186 3:156188188-156188210
Sequence CCAGCTTCCCTTGGTAAGTTTAT TTTTATGGCTTATCTCCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 179} {0: 1, 1: 0, 2: 0, 3: 15, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!