ID: 964411110_964411115

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 964411110 964411115
Species Human (GRCh38) Human (GRCh38)
Location 3:156398821-156398843 3:156398846-156398868
Sequence CCCACACCATAGTGGGTTGTCTC GGAGCATATCCATCCTATTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77} {0: 1, 1: 0, 2: 1, 3: 3, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!