ID: 964437275_964437278

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 964437275 964437278
Species Human (GRCh38) Human (GRCh38)
Location 3:156667399-156667421 3:156667434-156667456
Sequence CCTTCTTTACTATAAAAACAGAG AGTGCCTGAATAGCAAAAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!