ID: 964438248_964438258

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 964438248 964438258
Species Human (GRCh38) Human (GRCh38)
Location 3:156675518-156675540 3:156675555-156675577
Sequence CCTGCTGAGGGGAAGGCGGGGGC ACACCCGGAATTGCAGAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 426} {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!