ID: 964500818_964500820

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 964500818 964500820
Species Human (GRCh38) Human (GRCh38)
Location 3:157346432-157346454 3:157346451-157346473
Sequence CCAAATGTTTGAAAGACCAGTTT GTTTCTAAGTTGAAATTAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 524} {0: 1, 1: 0, 2: 1, 3: 17, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!