|
Left Crispr |
Right Crispr |
Crispr ID |
964520830 |
964520833 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:157564453-157564475
|
3:157564480-157564502
|
Sequence |
CCCGTATCACTATCAGCATTTTG |
AAACCATTCAACACGTCTCTAGG |
Strand |
- |
+ |
Off-target summary |
{0: 4, 1: 46, 2: 86, 3: 86, 4: 237} |
{0: 3, 1: 367, 2: 2053, 3: 1996, 4: 1368} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|