|
Left Crispr |
Right Crispr |
| Crispr ID |
964522395 |
964522406 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:157583191-157583213
|
3:157583232-157583254
|
| Sequence |
CCCCCAGAGTTTAACAGGCCCTT |
ATGCACTTGGAGGGTTAGAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 9, 2: 41, 3: 41, 4: 101} |
{0: 7, 1: 12, 2: 30, 3: 23, 4: 150} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|