ID: 964581287_964581291

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 964581287 964581291
Species Human (GRCh38) Human (GRCh38)
Location 3:158241372-158241394 3:158241415-158241437
Sequence CCAGGAGGCAGAAGCTGCAGTGA CTCCAGTAGCACTCTGGCTGGGG
Strand - +
Off-target summary {0: 144, 1: 6363, 2: 62244, 3: 119296, 4: 164415} {0: 1, 1: 0, 2: 0, 3: 16, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!