|
Left Crispr |
Right Crispr |
| Crispr ID |
964583402 |
964583405 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:158266754-158266776
|
3:158266771-158266793
|
| Sequence |
CCCCTCTTTTTGATACAGGGTTT |
GGGTTTCACTCCTGTTGCCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 12, 3: 107, 4: 730} |
{0: 28, 1: 545, 2: 12873, 3: 23851, 4: 30711} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|