|
Left Crispr |
Right Crispr |
| Crispr ID |
964583402 |
964583411 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:158266754-158266776
|
3:158266796-158266818
|
| Sequence |
CCCCTCTTTTTGATACAGGGTTT |
GGAGTGCAATGGTATGATCTCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 12, 3: 107, 4: 730} |
{0: 332, 1: 11801, 2: 59931, 3: 120853, 4: 151164} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|