|
Left Crispr |
Right Crispr |
| Crispr ID |
964589059 |
964589064 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:158340612-158340634
|
3:158340644-158340666
|
| Sequence |
CCCAGCCATGTGGAACTGTAAGA |
CCTCTTTCTGTTCCCAGTGTCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 12, 1: 2037, 2: 6082, 3: 7328, 4: 7654} |
{0: 1, 1: 2, 2: 89, 3: 674, 4: 890} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|