|
Left Crispr |
Right Crispr |
Crispr ID |
964589060 |
964589064 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:158340613-158340635
|
3:158340644-158340666
|
Sequence |
CCAGCCATGTGGAACTGTAAGAC |
CCTCTTTCTGTTCCCAGTGTCGG |
Strand |
- |
+ |
Off-target summary |
{0: 10, 1: 1935, 2: 5665, 3: 7016, 4: 7420} |
{0: 1, 1: 2, 2: 89, 3: 674, 4: 890} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|