|
Left Crispr |
Right Crispr |
Crispr ID |
964589348 |
964589354 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:158342511-158342533
|
3:158342544-158342566
|
Sequence |
CCCAGCCATGTGGAACCATAAAT |
CTCTTTCTGTTCCCAGTTTCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 49, 2: 416, 3: 3104, 4: 7182} |
{0: 5, 1: 83, 2: 160, 3: 868, 4: 1409} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|