|
Left Crispr |
Right Crispr |
| Crispr ID |
964589349 |
964589354 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:158342512-158342534
|
3:158342544-158342566
|
| Sequence |
CCAGCCATGTGGAACCATAAATC |
CTCTTTCTGTTCCCAGTTTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 43, 2: 406, 3: 2952, 4: 6602} |
{0: 5, 1: 83, 2: 160, 3: 868, 4: 1409} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|