ID: 964591902_964591905

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 964591902 964591905
Species Human (GRCh38) Human (GRCh38)
Location 3:158374070-158374092 3:158374105-158374127
Sequence CCAACTTTATTATATGCACATAG TTATGTTTTTTGAATACAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 208} {0: 1, 1: 0, 2: 1, 3: 43, 4: 703}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!