ID: 964599533_964599535

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 964599533 964599535
Species Human (GRCh38) Human (GRCh38)
Location 3:158481799-158481821 3:158481834-158481856
Sequence CCATTTTCTATTTGGATGAACTC TCATTTAAATGATAATAATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 305} {0: 1, 1: 0, 2: 3, 3: 60, 4: 558}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!